Probing hydrogen bonding in a DNA triple helix using protium-deuterium fractionation factors

In this communication we report protium-deuterium fractionation factors for the intramolecular triple helix formed by the DNA oligonucleotide 5'-d(AGAGAGAACCCCTTCTCTCTTTTTCTCTCTT)-3'. The fractionation factors of individual Watson-Crick and Hoogsteen hydrogen bonds in the structure are measured by NMR spectroscopy. The results show that, in contrast to proteins, the fractionation factors are all equal or lower than unity. On the average, the values of the fractionation factors are centered between 0.6 and 0.8, and no significant differences are observed between Hoogsteen and Watson-Crick hydrogen bonds. Deviations from the average are observed for the 5'-end region of the molecule where a base triad is absent and the structure is strained by the intramolecular folding of the DNA strand.     

Helical poly(3-methyl-4-vinylpyridine)/amino acid complexes: preparation, characterization, and biocompatibility

Helical poly(3-methyl-4-vinylpyridine) (P3M4VP)/amino acid complexes have been prepared via acid-base reaction of the achiral polymer with D and L amino acids: alanine, leucine, valine, serine and phenylalanine. The circular dichroism (CD) spectra of P3M4VP/D- and L-alanine complexes in CH(3)OH/H(2)O show opposing (near mirror image) Cotton effect signals at 278.4, 274.8 and 270.8 nm, indicating the formation of enantiomeric secondary structures. The formation of the enantiomeric structures is supported by observed [alpha](D)(25) values of -3.0 and +3.0 for the P3M4VP/D-alanine and P3M4VP/L-alanine complexes, respectively. The preparation of helical P3M4VP/amino acid complexes has been carried out in CH(3)OH and H(2)O at pH 1.8 and 2.7. The intensities of the Cotton effect signals were good. For example, for the P3M4VP/L-alanine complexes in CH(3)OH/H(2)O and H(2)O (pH 1.8), the second Cotton effect signal around 275-277 nm show [theta;] values of 49 980 and 79 210 deg . cm(2) . dmol(-1), respectively. The formation of the helical secondary structure is rapid. The acid-base reaction between P3M4VP and L-alanine in CH(3)OH/H(2)O, in 10 min, show a CD spectrum with Cotton effect signals at 274 and 272 nm with [theta] values of 27,000 deg . cm(2) . dmol(-1) and -36,000 deg . cm(2) . dmol(-1), respectively. P3M4VP permits ready conformational reorientation on complexation with amino acids, but once the helical P3M4VP/amino acid complexes are formed, it is stable at room temperature. P3M4VP is not compatible with HeLa ovarian cancer cells, but the helical P3M4VP/amino acid complexes are compatible with HeLa cells. The complexes minimally interfere with the adhesion and growth of HeLa cells on complex surfaces. Helical poly(3-methyl-4-vinylpyridine)/D- and L-alanine complexes support the attachment and growth of HeLa cells. The micrographs shows HeLa cells after three days: left panel: on P3M4VP/L-alanine complex; right panel: on P3M4VP/D-alanine complex.     

Employing the structural diversity of nature: development of modular dipeptide-analogue ligands for ruthenium-catalyzed enantioselective transfer hydrogenation of ketones

A library of novel dipeptide-analogue ligands based on the combination of tert-butoxycarbonyl(N-Boc)-protected alpha-amino acids and chiral vicinal amino alcohols were prepared. These highly modular ligands were combined with [[RuCl(2)(p-cymene)](2)] and the resulting metal complexes were screened as catalysts for the enantioselective reduction of acetophenone under transfer hydrogenation conditions using 2-propanol as the hydrogen donor. Excellent enantioselectivity of 1-phenylethanol (up to 98 % ee) was achieved with several of the novel catalysts. Although most of the ligands contained two stereocenters, it was demonstrated that the absolute configuration of the product alcohol was determined by the configuration of the amino acid part of the ligand. Employing ligands based on L-amino acids generated S-configured products, and catalysts based on D-amino acids favored the formation of the R-configured alcohol. The combination N-Boc-L-alanine and (R)-phenylglycinol (Boc-L-Ab) or its enantiomer (N-Boc-D-alanine and (S)-phenylglycinol, Boc-D-Aa) proved to be the best ligands for the reduction process. Transfer hydrogenation of a number of aryl alkyl ketones were evaluated and excellent enantioselectivity, up to 96 % ee, was obtained.     

Determination of the enantiomeric composition of guest molecules by chemometric analysis of the UV-visible spectra of cyclodextrin guest-host complexes

Multivariate statistical techniques were applied to the UV spectra of a series of solutions at pH 12 containing a fixed concentration (30 mM) of beta-cyclodextrin (beta-CD) and a fixed concentration (15 mM) of 2-phenylglycine (phi-Gly) with various known enantiomeric compositions. Multivariate correlation of the spectral data for the solutions containing the phi-Gly/beta-CD guest-host complexes with the known enantiomeric composition of the phi-Gly samples was accomplished by partial-least-squares regression. When the multivariate model was used to predict the enantiomeric purity of a test set of samples over the mol fraction range of 0.5-0.9 R-phi-Gly, the average magnitude of the relative errors in the mol fraction determination of enantiomeric composition was 3%. A plot of the enantiomeric composition predicted by the model versus the known enantiomeric composition of the calibration set gave a straight line with a correlation coefficient of 0.955, a slope of 1.05, and an offset of 5.61 x 10-4.